ID: 975861875_975861881

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 975861875 975861881
Species Human (GRCh38) Human (GRCh38)
Location 4:78686129-78686151 4:78686144-78686166
Sequence CCCAAGGGCAGTTCCCCAAAGAC CCAAAGACAGCCACAGATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126} {0: 1, 1: 0, 2: 1, 3: 18, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!