ID: 976034205_976034208

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 976034205 976034208
Species Human (GRCh38) Human (GRCh38)
Location 4:80795814-80795836 4:80795851-80795873
Sequence CCACTAACAGACCAAGATCTGTC AGTTATTTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 205, 4: 302} {0: 8, 1: 196, 2: 191, 3: 115, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!