|
Left Crispr |
Right Crispr |
Crispr ID |
976888043 |
976888053 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:90009608-90009630
|
4:90009661-90009683
|
Sequence |
CCAACCAAGTATCTGCTGTCTTC |
ATAAACTTAAGGTAAAGGGGTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 188, 1: 446, 2: 399, 3: 274, 4: 531} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|