ID: 977465998_977466000

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 977465998 977466000
Species Human (GRCh38) Human (GRCh38)
Location 4:97383344-97383366 4:97383371-97383393
Sequence CCTGCCATCTTCTGCAGATAACT TCCTTTTGAGAGACAACTCTTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 17, 1: 200, 2: 191, 3: 170, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!