|
Left Crispr |
Right Crispr |
| Crispr ID |
977490070 |
977490075 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:97700063-97700085
|
4:97700094-97700116
|
| Sequence |
CCAGTAACAGGCCAAGAGCTGTC |
GGAGAGTAGTTATCCACAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 162, 1: 189, 2: 129, 3: 114, 4: 178} |
{0: 1, 1: 0, 2: 7, 3: 14, 4: 179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|