ID: 977490070_977490077

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 977490070 977490077
Species Human (GRCh38) Human (GRCh38)
Location 4:97700063-97700085 4:97700099-97700121
Sequence CCAGTAACAGGCCAAGAGCTGTC GTAGTTATCCACAGATGGCAGGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} {0: 1, 1: 0, 2: 3, 3: 15, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!