ID: 977556174_977556179

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 977556174 977556179
Species Human (GRCh38) Human (GRCh38)
Location 4:98489576-98489598 4:98489613-98489635
Sequence CCGTCCACCACTGCTGATTGCCG ACCACTGACTTCCACCCCTCCGG
Strand - +
Off-target summary {0: 4, 1: 73, 2: 145, 3: 74, 4: 147} {0: 8, 1: 35, 2: 96, 3: 118, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!