|
Left Crispr |
Right Crispr |
| Crispr ID |
977556174 |
977556184 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:98489576-98489598
|
4:98489624-98489646
|
| Sequence |
CCGTCCACCACTGCTGATTGCCG |
CCACCCCTCCGGATCCGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 73, 2: 145, 3: 74, 4: 147} |
{0: 14, 1: 74, 2: 165, 3: 149, 4: 153} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|