ID: 977578202_977578206

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 977578202 977578206
Species Human (GRCh38) Human (GRCh38)
Location 4:98697077-98697099 4:98697097-98697119
Sequence CCTAAAGAAACCTGAAAAACTAG TAGTTCAGGCCATGACAGGAAGG
Strand - +
Off-target summary No data {0: 5, 1: 32, 2: 123, 3: 177, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!