ID: 979273574_979273579

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 979273574 979273579
Species Human (GRCh38) Human (GRCh38)
Location 4:118791548-118791570 4:118791563-118791585
Sequence CCCTCCACGGTCTCCCTCTGATG CTCTGATGCCGAGCCGAGACTGG
Strand - +
Off-target summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} {0: 1, 1: 72, 2: 557, 3: 573, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!