ID: 979659083_979659088

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 979659083 979659088
Species Human (GRCh38) Human (GRCh38)
Location 4:123231853-123231875 4:123231906-123231928
Sequence CCAGTTGGTGGAACAATCAGAAT TCTTATATGGGCATGGTTTGTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 32, 3: 134, 4: 324} {0: 25, 1: 61, 2: 188, 3: 315, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!