ID: 980524823_980524827

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 980524823 980524827
Species Human (GRCh38) Human (GRCh38)
Location 4:133976118-133976140 4:133976132-133976154
Sequence CCCAACAGAGCCCAGTTTGTGTT GTTTGTGTTGTTCCTCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 405, 4: 1973} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!