ID: 981331399_981331402

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 981331399 981331402
Species Human (GRCh38) Human (GRCh38)
Location 4:143513989-143514011 4:143514009-143514031
Sequence CCTCGATCGCCAGCGGCGGGAGC AGCAACAGCAGCAACAAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 9, 3: 88, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!