ID: 981446606_981446607 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 981446606 | 981446607 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:144846533-144846555 | 4:144846553-144846575 |
| Sequence | CCAGGGTTTGGTGACAATAGAAA | AAACAACCAGCTTAAAGATATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 5, 2: 4, 3: 17, 4: 293} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||