ID: 982040247_982040251

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 982040247 982040251
Species Human (GRCh38) Human (GRCh38)
Location 4:151390193-151390215 4:151390208-151390230
Sequence CCTTCCACGGTCTCCCTCTGATG CTCTGATGCTGAGCCAAAGCTGG
Strand - +
Off-target summary No data {0: 16, 1: 194, 2: 592, 3: 605, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!