ID: 982388297_982388301

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 982388297 982388301
Species Human (GRCh38) Human (GRCh38)
Location 4:154836743-154836765 4:154836756-154836778
Sequence CCAGCCAAGCAGTCTCATTGTTA CTCATTGTTAGAAGCTGGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 6, 3: 12, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!