ID: 982745991_982746000

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 982745991 982746000
Species Human (GRCh38) Human (GRCh38)
Location 4:159104018-159104040 4:159104037-159104059
Sequence CCCCGCGCCGCCGCCGCCGCGGT CGGTTTGGCTGATTAGTCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!