ID: 982745991_982746002

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 982745991 982746002
Species Human (GRCh38) Human (GRCh38)
Location 4:159104018-159104040 4:159104041-159104063
Sequence CCCCGCGCCGCCGCCGCCGCGGT TTGGCTGATTAGTCGCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 41, 3: 281, 4: 1082} {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!