ID: 982978783_982978791 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 982978783 | 982978791 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:162104067-162104089 | 4:162104114-162104136 |
| Sequence | CCGTCCACCACTGCTGTTTGCCA | CCATCCCTCCGGATCCAGCAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 20, 1: 71, 2: 130, 3: 138, 4: 219} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||