ID: 983582673_983582678

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 983582673 983582678
Species Human (GRCh38) Human (GRCh38)
Location 4:169324782-169324804 4:169324827-169324849
Sequence CCTGCCATCTTCTGCAGATAACT CTTGGCTTGTTACTGGGTTTTGG
Strand - +
Off-target summary No data {0: 2, 1: 15, 2: 194, 3: 183, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!