ID: 984140868_984140875

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 984140868 984140875
Species Human (GRCh38) Human (GRCh38)
Location 4:176002316-176002338 4:176002352-176002374
Sequence CCGAGGTCCTGCTTCTCTGCAGT CGAGTGACCAGACGCTGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 50, 4: 362} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!