ID: 984512980_984512989

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 984512980 984512989
Species Human (GRCh38) Human (GRCh38)
Location 4:180701570-180701592 4:180701604-180701626
Sequence CCAACAGGAGCAAACTCCATTCA GGGGTCCACCCCTCACAGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!