ID: 984588132_984588140

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 984588132 984588140
Species Human (GRCh38) Human (GRCh38)
Location 4:181586518-181586540 4:181586552-181586574
Sequence CCCAGTTCAAGTGGTGGAGTTCC AACCAAAGGGCCAGGTGCGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 97, 3: 910, 4: 5320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!