ID: 984734939_984734957

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 984734939 984734957
Species Human (GRCh38) Human (GRCh38)
Location 4:183099650-183099672 4:183099698-183099720
Sequence CCGTTCGGACACGGCGGCTGTTG GCTGGGGCGGCGCCGGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25} {0: 1, 1: 1, 2: 3, 3: 53, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!