ID: 984964566_984964581

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 984964566 984964581
Species Human (GRCh38) Human (GRCh38)
Location 4:185128687-185128709 4:185128726-185128748
Sequence CCTGGCCCTCGGCGCCGGGACCC TAGCGACTGGTGGCCTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!