ID: 985350735_985350750

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 985350735 985350750
Species Human (GRCh38) Human (GRCh38)
Location 4:189058672-189058694 4:189058719-189058741
Sequence CCCAGACCCTCCCTTGACTTCTC ACTGCGTTTCTGATCCAGCAAGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 17, 3: 57, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!