ID: 985403793_985403798

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 985403793 985403798
Species Human (GRCh38) Human (GRCh38)
Location 4:189616584-189616606 4:189616616-189616638
Sequence CCAGTGGATCCCGCACAGGGGCT GCTGCCTGCCAGTCCCGCGCCGG
Strand - +
Off-target summary {0: 24, 1: 221, 2: 409, 3: 327, 4: 334} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!