ID: 985403796_985403798 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 985403796 | 985403798 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:189616593-189616615 | 4:189616616-189616638 |
| Sequence | CCCGCACAGGGGCTGCAGGTGGA | GCTGCCTGCCAGTCCCGCGCCGG |
| Strand | - | + |
| Off-target summary | {0: 40, 1: 408, 2: 475, 3: 344, 4: 587} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||