ID: 985453240_985453252

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 985453240 985453252
Species Human (GRCh38) Human (GRCh38)
Location 4:190071837-190071859 4:190071885-190071907
Sequence CCCACAGGGGGCTTTCGTGAGCC GCAGCCCAGCCAGGCCGCGCCGG
Strand - +
Off-target summary {0: 37, 1: 11, 2: 10, 3: 6, 4: 79} {0: 24, 1: 6, 2: 16, 3: 48, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!