|
Left Crispr |
Right Crispr |
| Crispr ID |
985455218 |
985455227 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:190078423-190078445
|
4:190078462-190078484
|
| Sequence |
CCCACAGGGGGCTTTCGTGAGCC |
CCCCGCGCTGCAGCCCAGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 37, 1: 11, 2: 10, 3: 6, 4: 79} |
{0: 25, 1: 0, 2: 19, 3: 85, 4: 1032} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|