ID: 985457190_985457202 |
View in Genome Browser |
Spacer: 25 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 985457190 | 985457202 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:190085017-190085039 | 4:190085065-190085087 |
| Sequence | CCCACAGGGGGCTTTCGTGAGCC | GCAGCCCAGCCAGGCCGCGCCGG |
| Strand | - | + |
| Off-target summary | {0: 37, 1: 11, 2: 10, 3: 6, 4: 79} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||