ID: 985587977_985587989

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 985587977 985587989
Species Human (GRCh38) Human (GRCh38)
Location 5:750780-750802 5:750811-750833
Sequence CCACCCTCCCACAGCTACATGGC ATGGTGTGACAGGTGCTACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 251} {0: 2, 1: 0, 2: 1, 3: 10, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!