ID: 985684279_985684288

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 985684279 985684288
Species Human (GRCh38) Human (GRCh38)
Location 5:1273575-1273597 5:1273618-1273640
Sequence CCATCCACAGTCACCACATCAGA GTCACCACACATCAGACCCCCGG
Strand - +
Off-target summary {0: 12, 1: 0, 2: 2, 3: 22, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!