ID: 985779884_985779898

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 985779884 985779898
Species Human (GRCh38) Human (GRCh38)
Location 5:1864992-1865014 5:1865036-1865058
Sequence CCACCTGCCTCTCCCCACCTATG GCAGGGCTGTGAATCCCGCACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!