ID: 985903290_985903308

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 985903290 985903308
Species Human (GRCh38) Human (GRCh38)
Location 5:2813770-2813792 5:2813819-2813841
Sequence CCTCAGAGGCTGACCCTGCTTGG AGGGGAGGTAGGAGCAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!