ID: 986399012_986399016

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 986399012 986399016
Species Human (GRCh38) Human (GRCh38)
Location 5:7361348-7361370 5:7361392-7361414
Sequence CCCGACTACCTTCATCAAAGAAA CACTGAAGAAAGGAAAATGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!