ID: 986912413_986912420

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 986912413 986912420
Species Human (GRCh38) Human (GRCh38)
Location 5:12574255-12574277 5:12574273-12574295
Sequence CCCACGCCCACCCGGAACTCCAG TCCAGCTGGCCCGCAAGCGCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!