|
Left Crispr |
Right Crispr |
| Crispr ID |
987251726 |
987251730 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:16107727-16107749
|
5:16107753-16107775
|
| Sequence |
CCAGGCTCCAGGAGCAGATGAGG |
TGAGGAGACAAGCAGACAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 15, 2: 34, 3: 121, 4: 499} |
{0: 6, 1: 6, 2: 16, 3: 56, 4: 434} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|