ID: 987260166_987260173

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 987260166 987260173
Species Human (GRCh38) Human (GRCh38)
Location 5:16195221-16195243 5:16195248-16195270
Sequence CCCTTAGGAAGGGGGCTAAATCC GGCCAAGCAACATCAGTCTGTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 17, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!