ID: 987340305_987340317

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 987340305 987340317
Species Human (GRCh38) Human (GRCh38)
Location 5:16934218-16934240 5:16934253-16934275
Sequence CCCCCACTTGCACTAGGGGGCAG GGGGGAGCCACGGACCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 1, 3: 22, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!