ID: 987747673_987747676

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 987747673 987747676
Species Human (GRCh38) Human (GRCh38)
Location 5:21997152-21997174 5:21997177-21997199
Sequence CCAGCATATTGCAGCAAACAGGT AGAGTCTGGGAACGAAACTCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 90} {0: 1, 1: 2, 2: 1, 3: 10, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!