ID: 988107755_988107759

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 988107755 988107759
Species Human (GRCh38) Human (GRCh38)
Location 5:26772517-26772539 5:26772555-26772577
Sequence CCTGCCATCTTCTGCAGATAACT GACAGCTCTTGGCTTTTTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 228, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!