ID: 988188771_988188774

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 988188771 988188774
Species Human (GRCh38) Human (GRCh38)
Location 5:27901207-27901229 5:27901234-27901256
Sequence CCTGCCATCTTCTGCAGATAACC TCCTTTTAAGAGACAGCTCTTGG
Strand - +
Off-target summary {0: 10, 1: 193, 2: 189, 3: 116, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!