ID: 988551471_988551478

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 988551471 988551478
Species Human (GRCh38) Human (GRCh38)
Location 5:32204564-32204586 5:32204581-32204603
Sequence CCTTGACCCTCTCTCCGCTCCTC CTCCTCCAGACCACTCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 659} {0: 1, 1: 1, 2: 2, 3: 9, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!