|
Left Crispr |
Right Crispr |
| Crispr ID |
988562127 |
988562129 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:32290818-32290840
|
5:32290845-32290867
|
| Sequence |
CCTGCCATCTTCTGCAGATAACG |
TCCTTTTGAAAGACAGCTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 200, 2: 181, 3: 114, 4: 170} |
{0: 7, 1: 195, 2: 205, 3: 190, 4: 402} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|