|
Left Crispr |
Right Crispr |
Crispr ID |
988562127 |
988562131 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:32290818-32290840
|
5:32290856-32290878
|
Sequence |
CCTGCCATCTTCTGCAGATAACG |
GACAGCTCTTGGCCCGTTACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 200, 2: 181, 3: 114, 4: 170} |
{0: 5, 1: 170, 2: 191, 3: 131, 4: 143} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|