ID: 988577981_988577991

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 988577981 988577991
Species Human (GRCh38) Human (GRCh38)
Location 5:32444773-32444795 5:32444817-32444839
Sequence CCTGTGCTCGGCATCCTGGGAGC GGCTCCCCCGGGCGCGTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181} {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!