ID: 988577982_988577991

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 988577982 988577991
Species Human (GRCh38) Human (GRCh38)
Location 5:32444787-32444809 5:32444817-32444839
Sequence CCTGGGAGCTGTAGTCCCCGCCG GGCTCCCCCGGGCGCGTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 138} {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!