ID: 988577982_988578002

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 988577982 988578002
Species Human (GRCh38) Human (GRCh38)
Location 5:32444787-32444809 5:32444838-32444860
Sequence CCTGGGAGCTGTAGTCCCCGCCG GGGCCTCGGCGGTGCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 138} {0: 1, 1: 1, 2: 7, 3: 40, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!