ID: 989545339_989545349

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 989545339 989545349
Species Human (GRCh38) Human (GRCh38)
Location 5:42665965-42665987 5:42665999-42666021
Sequence CCCCATGATTCAATTACCTTCCA TCATGACACATGCGGATTATGGG
Strand - +
Off-target summary {0: 178, 1: 3381, 2: 6698, 3: 9592, 4: 11032} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!